Sequence retrieval

Genome: Ralstonia pickettii 12J
Start position: 1200875
End position: 1200899
Length: 25

DNA sequence
>NC_010682, from 1200875 to 1200899 (25 bp); Ralstonia pickettii 12J GTTCAGTTCAATTCAGTACAGGTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 1200898-1202427	Sequence	Rpic_1124 - NodT family RND efflux system outer membrane lipoprotein (Protein is coded in complementary strand; from 1202427 to 1200898)