Sequence retrieval

Genome: Ralstonia pickettii 12J
Start position: 867281
End position: 867304
Length: 24

DNA sequence
>NC_010682, from 867281 to 867304 (24 bp); Ralstonia pickettii 12J GCTGTTGCTATTGCTGTTGCCGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 866928-868811	Sequence	Rpic_0823 - DEAD/DEAH box helicase (Protein is coded in complementary strand; from 868811 to 866928)