Sequence retrieval

Genome: Ralstonia pickettii 12J
Start position: 688400
End position: 688423
Length: 24

DNA sequence
>NC_010682, from 688400 to 688423 (24 bp); Ralstonia pickettii 12J AGCCGCGTGGCCGCGTAGCCGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 687782-688525	Sequence	Rpic_0648 - TetR family transcriptional regulator (Protein is coded in complementary strand; from 688525 to 687782)