Sequence retrieval

Genome: Ralstonia pickettii 12J
Start position: 448371
End position: 448394
Length: 24

DNA sequence
>NC_010682, from 448371 to 448394 (24 bp); Ralstonia pickettii 12J GCCGTTGCCGCTGTCGTTGCCGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 448066-449124	Sequence	Rpic_0418 - TetR family transcriptional regulator (Protein is coded in complementary strand; from 449124 to 448066)