Sequence retrieval

Genome: Ralstonia pickettii 12J
Start position: 431749
End position: 431772
Length: 24

DNA sequence
>NC_010682, from 431749 to 431772 (24 bp); Ralstonia pickettii 12J TGATCGTGGTCGTGATCATGGTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 431317-432531	Sequence	Rpic_0405 - hypothetical protein (Protein is coded in complementary strand; from 432531 to 431317)