Sequence retrieval

Genome: Ralstonia pickettii 12J
Start position: 3562998
End position: 3563021
Length: 24

DNA sequence
>NC_010682, from 3562998 to 3563021 (24 bp); Ralstonia pickettii 12J TCACGACATCACGACATCACCACA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 3563007-3563690	Sequence	Rpic_3402 - hypothetical protein (Protein is coded in complementary strand; from 3563690 to 3563007)