Sequence retrieval

Genome: Ralstonia pickettii 12J
Start position: 2975751
End position: 2975774
Length: 24

DNA sequence
>NC_010682, from 2975751 to 2975774 (24 bp); Ralstonia pickettii 12J CTCCTTCACCTTCTCCTGCACCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2974867-2976819	Sequence	Rpic_2870 dnaK molecular chaperone DnaK (Protein is coded in complementary strand; from 2976819 to 2974867)