Sequence retrieval

Genome: Ralstonia pickettii 12J
Start position: 2700586
End position: 2700609
Length: 24

DNA sequence
>NC_010682, from 2700586 to 2700609 (24 bp); Ralstonia pickettii 12J CACCGGCACTGGCTCCGGCGCCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2698805-2700964	Sequence	Rpic_2589 - 4Fe-4S ferredoxin (Protein is coded in complementary strand; from 2700964 to 2698805)