Sequence retrieval

Genome: Ralstonia pickettii 12J
Start position: 2661837
End position: 2661860
Length: 24

DNA sequence
>NC_010682, from 2661837 to 2661860 (24 bp); Ralstonia pickettii 12J GCCATCGCCACCGCCCTCGCCATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2661580-2663925	Sequence	Rpic_2556 - cell division protein FtsK (Protein is coded in complementary strand; from 2663925 to 2661580)