Sequence retrieval

Genome: Ralstonia pickettii 12J
Start position: 2523950
End position: 2523973
Length: 24

DNA sequence
>NC_010682, from 2523950 to 2523973 (24 bp); Ralstonia pickettii 12J GCTTCAGCTTCTTCTTCAGCTTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2522339-2524828	Sequence	Rpic_2420 - RNA polymerase sigma factor RpoD (Protein is coded in complementary strand; from 2524828 to 2522339)