Sequence retrieval

Genome: Ralstonia pickettii 12J
Start position: 2295906
End position: 2295929
Length: 24

DNA sequence
>NC_010682, from 2295906 to 2295929 (24 bp); Ralstonia pickettii 12J GGTGCCGGTGGCGGGGCCAGTGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2294686-2296404	Sequence	Rpic_2184 ureC urease subunit alpha (Protein is coded in complementary strand; from 2296404 to 2294686)