Sequence retrieval

Genome: Ralstonia pickettii 12J
Start position: 2117583
End position: 2117606
Length: 24

DNA sequence
>NC_010682, from 2117583 to 2117606 (24 bp); Ralstonia pickettii 12J TCAGGCCCAGGCTCAGGGCCAGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2117009-2117650	Sequence	Rpic_2011 - Lysine exporter protein LysE/YggA (Protein is coded in complementary strand; from 2117650 to 2117009)