Sequence retrieval

Genome: Ralstonia pickettii 12J
Start position: 2052452
End position: 2052475
Length: 24

DNA sequence
>NC_010682, from 2052452 to 2052475 (24 bp); Ralstonia pickettii 12J CGACAGCGACAGCGGCAGCGTCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2052360-2054033	Sequence	Rpic_1946 - dihydrolipoamide acetyltransferase (Protein is coded in complementary strand; from 2054033 to 2052360)