Sequence retrieval

Genome: Ralstonia pickettii 12J
Start position: 2018143
End position: 2018166
Length: 24

DNA sequence
>NC_010682, from 2018143 to 2018166 (24 bp); Ralstonia pickettii 12J TCTGCATCTGCTCCTGCATCTGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2018085-2018639	Sequence	Rpic_1913 - polyhydroxyalkonate synthesis repressor PhaR (Protein is coded in complementary strand; from 2018639 to 2018085)