Sequence retrieval

Genome: Ralstonia pickettii 12J
Start position: 2005214
End position: 2005237
Length: 24

DNA sequence
>NC_010682, from 2005214 to 2005237 (24 bp); Ralstonia pickettii 12J CGCCGGCGCGGGAGCCGGTGCCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2004529-2005287	Sequence	Rpic_1903 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase (Protein is coded in complementary strand; from 2005287 to 2004529)