Sequence retrieval

Genome: Ralstonia pickettii 12J
Start position: 1951379
End position: 1951402
Length: 24

DNA sequence
>NC_010682, from 1951379 to 1951402 (24 bp); Ralstonia pickettii 12J CACCGCCACCGCCGCCGCCACCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1948063-1952031	Sequence	Rpic_1857 - outer membrane autotransporter barrel domain-containing protein (Protein is coded in complementary strand; from 1952031 to 1948063)