Sequence retrieval

Genome: Ralstonia pickettii 12J
Start position: 180795
End position: 180818
Length: 24

DNA sequence
>NC_010682, from 180795 to 180818 (24 bp); Ralstonia pickettii 12J GGCAATGGCAATCGCAATGGCGAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 180211-180906	Sequence	Rpic_0162 - glutathione peroxidase (Protein is coded in complementary strand; from 180906 to 180211)