Sequence retrieval

Genome: Ralstonia pickettii 12J
Start position: 1534101
End position: 1534124
Length: 24

DNA sequence
>NC_010682, from 1534101 to 1534124 (24 bp); Ralstonia pickettii 12J CGGCGGCAGCGGCGGCAGCGGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1533473-1534651	Sequence	Rpic_1445 - acetyl-CoA acetyltransferase (Protein is coded in complementary strand; from 1534651 to 1533473)