Sequence retrieval

Genome: Ralstonia pickettii 12J
Start position: 1200746
End position: 1200769
Length: 24

DNA sequence
>NC_010682, from 1200746 to 1200769 (24 bp); Ralstonia pickettii 12J TTGCCGTTGCCGTTGCCGTTGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1199552-1200841	Sequence	Rpic_1123 - secretion protein HlyD family protein (Protein is coded in complementary strand; from 1200841 to 1199552)