Sequence retrieval

Genome: Ralstonia pickettii 12J
Start position: 1014335
End position: 1014358
Length: 24

DNA sequence
>NC_010682, from 1014335 to 1014358 (24 bp); Ralstonia pickettii 12J GGCCGAGGCCGAAGCCGAGGTCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1013497-1015191	Sequence	Rpic_0958 - single-stranded-DNA-specific exonuclease RecJ (Protein is coded in complementary strand; from 1015191 to 1013497)