Sequence retrieval

Genome: Bordetella avium 197N
Start position: 935396
End position: 935419
Length: 24

DNA sequence
>NC_010645, from 935396 to 935419 (24 bp); Bordetella avium 197N CATGAGCACGAGCAAGAGCATGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 935142-936419	Sequence	BAV0888 gltT proton/sodium-glutamate symport protein (Protein is coded in complementary strand; from 936419 to 935142)