Sequence retrieval

Genome: Bordetella avium 197N
Start position: 601343
End position: 601369
Length: 27

DNA sequence
>NC_010645, from 601343 to 601369 (27 bp); Bordetella avium 197N CCATGCCGCCCATGCCACCCATGCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 601336-602976	Sequence	BAV0579 groEL chaperonin GroEL (Protein is coded in complementary strand; from 602976 to 601336)