Sequence retrieval

Genome: Bordetella avium 197N
Start position: 569609
End position: 569644
Length: 36

DNA sequence
>NC_010645, from 569609 to 569644 (36 bp); Bordetella avium 197N GGCGGAAAGCTCGGTGGAAAGCTCGGCGGTAAGCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 568944-570164	Sequence	BAV0545 hsdS type i restriction enzyme EcoR124II specificity protein (Protein is coded in complementary strand; from 570164 to 568944)