Sequence retrieval

Genome: Bordetella avium 197N
Start position: 3461114
End position: 3461138
Length: 25

DNA sequence
>NC_010645, from 3461114 to 3461138 (25 bp); Bordetella avium 197N CTGCGCGGCGCAGCGCTGGGCTGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3460478-3461692	Sequence	BAV3185 ampG muropeptide transporter (Protein is coded in complementary strand; from 3461692 to 3460478)