Sequence retrieval

Genome: Bordetella avium 197N
Start position: 325049
End position: 325090
Length: 42

DNA sequence
>NC_010645, from 325049 to 325090 (42 bp); Bordetella avium 197N ATTGCGGATTGCGGATTGCGGATTGCGGATTGCGGATTGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 324428-325099	Sequence	BAV0313 - fimbrial subunit (Protein is coded in complementary strand; from 325099 to 324428)