Sequence retrieval

Genome: Bordetella avium 197N
Start position: 3182344
End position: 3182376
Length: 33

DNA sequence
>NC_010645, from 3182344 to 3182376 (33 bp); Bordetella avium 197N TCAACGGCTGCTCAAGGGCCGCTCAAGGGCTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 3182356-3183192	Sequence	BAV2925 - hypothetical protein (Protein is coded in complementary strand; from 3183192 to 3182356)