Sequence retrieval

Genome: Bordetella avium 197N
Start position: 3081953
End position: 3081976
Length: 24

DNA sequence
>NC_010645, from 3081953 to 3081976 (24 bp); Bordetella avium 197N CAGGGCCAGGGGCAAGGCCACGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3080229-3082139	Sequence	BAV2837 - membrane-associated sulfatase (Protein is coded in complementary strand; from 3082139 to 3080229)