Sequence retrieval

Genome: Bordetella avium 197N
Start position: 2267483
End position: 2267518
Length: 36

DNA sequence
>NC_010645, from 2267483 to 2267518 (36 bp); Bordetella avium 197N TGCGGTTTCGGCTGTGGTTTCGGCTGTGGTTTGGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2267087-2267890	Sequence	BAV2120 tonB siderophore-mediated iron transport protein (Protein is coded in complementary strand; from 2267890 to 2267087)