Sequence retrieval

Genome: Bordetella avium 197N
Start position: 2103288
End position: 2103317
Length: 30

DNA sequence
>NC_010645, from 2103288 to 2103317 (30 bp); Bordetella avium 197N GGCGGTGGCGGTGGCGGTGGCGGTGGCGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2102421-2110286	Sequence	BAV1966 fhaB Filamentous hemagglutinin/adhesin (Protein is coded in complementary strand; from 2110286 to 2102421)