Sequence retrieval

Genome: Bordetella avium 197N
Start position: 177026
End position: 177049
Length: 24

DNA sequence
>NC_010645, from 177026 to 177049 (24 bp); Bordetella avium 197N GGCCCTGGGCCTGGCCCGGGCCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 176533-177291	Sequence	BAV0172 ung uracil-DNA glycosylase (Protein is coded in complementary strand; from 177291 to 176533)