Sequence retrieval

Genome: Bordetella avium 197N
Start position: 1637658
End position: 1637687
Length: 30

DNA sequence
>NC_010645, from 1637658 to 1637687 (30 bp); Bordetella avium 197N GCGGAGGAGGAGACGGAGGAGGAGACGGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1635075-1638548	Sequence	BAV1572 - autotransporter (Protein is coded in complementary strand; from 1638548 to 1635075)