Sequence retrieval

Genome: Bordetella avium 197N
Start position: 1313730
End position: 1313753
Length: 24

DNA sequence
>NC_010645, from 1313730 to 1313753 (24 bp); Bordetella avium 197N GCGCGTGCCCGTGCGCATGAGCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1313123-1314085	Sequence	BAV1219 rluD ribosomal large subunit pseudouridine synthase D