Sequence retrieval

Genome: Bordetella avium 197N
Start position: 1184993
End position: 1185019
Length: 27

DNA sequence
>NC_010645, from 1184993 to 1185019 (27 bp); Bordetella avium 197N CGGCCGCGGCGGCTGCGGCGGCGGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1184285-1187332	Sequence	BAV1108 ams ribonuclease E (Protein is coded in complementary strand; from 1187332 to 1184285)