Sequence retrieval

Genome: Bordetella avium 197N
Start position: 1073561
End position: 1073596
Length: 36

DNA sequence
>NC_010645, from 1073561 to 1073596 (36 bp); Bordetella avium 197N CGGCGCGCAGGTCGGCGAGCAGCTCGTCGCGCAGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1072402-1073841	Sequence	BAV1002 - peptidase (Protein is coded in complementary strand; from 1073841 to 1072402)