Sequence retrieval

Genome: Bordetella avium 197N
Start position: 326654
End position: 326709
Length: 56

DNA sequence
>NC_010645, from 326654 to 326709 (56 bp); Bordetella avium 197N AATTGCGGATTGCGGATTGCGGATTGCGGATTGCGGATTGCGGATTGCGGATTGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 326049-326762	Sequence	BAV0315 - fimbrial subunit (Protein is coded in complementary strand; from 326762 to 326049)