Sequence retrieval

Genome: Elusimicrobium minutum Pei191
Start position: 1460528
End position: 1460554
Length: 27

DNA sequence
>NC_010644, from 1460528 to 1460554 (27 bp); Elusimicrobium minutum Pei191 CTTTCTGGTCTTTCTGATCTTTCTGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1460279-1460620	Sequence	Emin_1356 - 30S ribosomal protein S18 (Protein is coded in complementary strand; from 1460620 to 1460279)