Sequence retrieval

Genome: Elusimicrobium minutum Pei191
Start position: 797590
End position: 797614
Length: 25

DNA sequence
>NC_010644, from 797590 to 797614 (25 bp); Elusimicrobium minutum Pei191 AAAAAAAATAAAACACAAAAATAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 795871-797628	Sequence	Emin_0721 - hypothetical protein (Protein is coded in complementary strand; from 797628 to 795871)