Sequence retrieval

Genome: Elusimicrobium minutum Pei191
Start position: 1528183
End position: 1528207
Length: 25

DNA sequence
>NC_010644, from 1528183 to 1528207 (25 bp); Elusimicrobium minutum Pei191 AAAAAAGAAAATAAAAAAACAAAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1527931-1528326	Sequence	Emin_1435 - hypothetical protein (Protein is coded in complementary strand; from 1528326 to 1527931)