Sequence retrieval

Genome: Yersinia pseudotuberculosis PB1/+
Start position: 923469
End position: 923516
Length: 48

DNA sequence
>NC_010634, from 923469 to 923516 (48 bp); Yersinia pseudotuberculosis PB1/+ ATTAACGGGTGATGACATTAATAGATGATGACATTAATAGGTGATTAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 923514-924803	Sequence	YPTS_0819 - arsenical pump membrane protein (Protein is coded in complementary strand; from 924803 to 923514)