Sequence retrieval

Genome: Yersinia pseudotuberculosis PB1/+
Start position: 655727
End position: 655780
Length: 54

DNA sequence
>NC_010634, from 655727 to 655780 (54 bp); Yersinia pseudotuberculosis PB1/+ GCATAGTTATTTTTATCAACATGGTTACTTTTATCAACATAGTTACTTTTATCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 654851-656005	Sequence	YPTS_0592 - diguanylate cyclase (Protein is coded in complementary strand; from 656005 to 654851)