Sequence retrieval

Genome: Yersinia pseudotuberculosis PB1/+
Start position: 601401
End position: 601451
Length: 51

DNA sequence
>NC_010634, from 601401 to 601451 (51 bp); Yersinia pseudotuberculosis PB1/+ TAATGAAAGGTATTTATTAATGGAGCGTATTTATTAACGTAACGTATTTAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 601304-601438	Sequence	YPTS_0548 - hypothetical protein
ORF... 601452-601766	Sequence	YPTS_0549 - anaerobic ribonucleoside-triphosphate reductase activating protein (Protein is coded in complementary strand; from 601766 to 601452)