Sequence retrieval

Genome: Yersinia pseudotuberculosis PB1/+
Start position: 516203
End position: 516259
Length: 57

DNA sequence
>NC_010634, from 516203 to 516259 (57 bp); Yersinia pseudotuberculosis PB1/+ TTAACGTTACAGCAAAACATTAGCGTTATAGCAAAACATTAACGATACAGCAGAGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 516242-516553	Sequence	YPTS_0465 - putative biofilm stress and motility protein A (Protein is coded in complementary strand; from 516553 to 516242)