Sequence retrieval

Genome: Yersinia pseudotuberculosis PB1/+
Start position: 496287
End position: 496331
Length: 45

DNA sequence
>NC_010634, from 496287 to 496331 (45 bp); Yersinia pseudotuberculosis PB1/+ AGTCATGTTGTTCTAAGTCATGGAGCTCTAAGTCATGGCGATCTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 495500-496639	Sequence	YPTS_0447 - iron-sulfur cluster binding protein (Protein is coded in complementary strand; from 496639 to 495500)