Sequence retrieval

Genome: Yersinia pseudotuberculosis PB1/+
Start position: 4515352
End position: 4515387
Length: 36

DNA sequence
>NC_010634, from 4515352 to 4515387 (36 bp); Yersinia pseudotuberculosis PB1/+ GTCTCTGTCTCTGTCTCTGTCTCTGTCTCTGTCTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4513927-4516152	Sequence	YPTS_4042 - AsmA family protein (Protein is coded in complementary strand; from 4516152 to 4513927)