Sequence retrieval

Genome: Yersinia pseudotuberculosis PB1/+
Start position: 4383578
End position: 4383622
Length: 45

DNA sequence
>NC_010634, from 4383578 to 4383622 (45 bp); Yersinia pseudotuberculosis PB1/+ CACTGTTTGATGAAGTGCTATTTGATGAAGCACTGTTTGATAACT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4382323-4383825	Sequence	YPTS_3946 hofQ putative outer membrane porin HofQ (Protein is coded in complementary strand; from 4383825 to 4382323)