Sequence retrieval

Genome: Yersinia pseudotuberculosis PB1/+
Start position: 434114
End position: 434140
Length: 27

DNA sequence
>NC_010634, from 434114 to 434140 (27 bp); Yersinia pseudotuberculosis PB1/+ CTCTGGTGTCTCTGGTGTCTCTGGTGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 434091-436586	Sequence	YPTS_0391 - glycerol-3-phosphate acyltransferase (Protein is coded in complementary strand; from 436586 to 434091)