Sequence retrieval

Genome: Yersinia pseudotuberculosis PB1/+
Start position: 4338057
End position: 4338080
Length: 24

DNA sequence
>NC_010634, from 4338057 to 4338080 (24 bp); Yersinia pseudotuberculosis PB1/+ CATGCTCATGTTCATGTTCATGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4338014-4338601	Sequence	YPTS_3904 - FKBP-type peptidyl-prolyl cis-trans isomerase (Protein is coded in complementary strand; from 4338601 to 4338014)