Sequence retrieval

Genome: Yersinia pseudotuberculosis PB1/+
Start position: 4264608
End position: 4264667
Length: 60

DNA sequence
>NC_010634, from 4264608 to 4264667 (60 bp); Yersinia pseudotuberculosis PB1/+ CCCGAGCTATTATTTTTGATGAAGAGCTATTACTTTTGATGAAGAGCCATTATTTTTGAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 4264658-4265155	Sequence	YPTS_3822 - type VI secretion protein (Protein is coded in complementary strand; from 4265155 to 4264658)