Sequence retrieval

Genome: Yersinia pseudotuberculosis PB1/+
Start position: 4260792
End position: 4260845
Length: 54

DNA sequence
>NC_010634, from 4260792 to 4260845 (54 bp); Yersinia pseudotuberculosis PB1/+ GCCTCAACCCCATTTACATTCTCAACCCCACTTACATCCTCAACCACACTTACA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4259790-4260878	Sequence	YPTS_3818 - type VI secretion protein (Protein is coded in complementary strand; from 4260878 to 4259790)
ORF... 4260842-4262662	Sequence	YPTS_3819 - type VI secretion protein (Protein is coded in complementary strand; from 4262662 to 4260842)