Sequence retrieval

Genome: Yersinia pseudotuberculosis PB1/+
Start position: 4188329
End position: 4188382
Length: 54

DNA sequence
>NC_010634, from 4188329 to 4188382 (54 bp); Yersinia pseudotuberculosis PB1/+ TTACTCATACTAAAAACAATACTCATACTAAAAACAATACTCAGGCTAAAAACA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4188317-4189417	Sequence	YPTS_3755 - putative sulfite oxidase subunit YedY